Property talk:P4864

Documentation

• Start a query
• Current uses
• Statistics by class
• String length
• List of qualifiers
• Count

cutting site of restriction enzyme
DNA cutting site of restriction enzyme, written from 5' to 3'

Represents	restriction enzyme (Q219715)
Data type	String
Domain	restriction enzyme (Q219715)
Allowed values	According to this template: ([ACGTRMWSYKHBDVN]*\^[ACGTRMWSYKHBDVN]*|(\(\d+\/\d+\))?[ACGTRMWSYKHBDVN]+\(\d+\/\d+\)); expression methods of cutting sites are according to REBASE According to statements in the property: ([ACGTRMWSYKHBDVN]*\^[ACGTRMWSYKHBDVN]*|(\(-?\d+\/-?\d+\))?[ACGTRMWSYKHBDVN]+\(-?\d+\/-?\d+\)) When possible, data should only be stored as statements
Example	EcoRI (Q417754) → G^AATTC SmaI (Q6130415) → CCC^GGG
See also	recognition sequence (P4863), isoschizomer (P4873), neoschizomer (P4875)
Lists	Items with the most statements of this property Count of items by number of statements (chart) Items with the most statements Items with the fewest statements Count of items by number of sitelinks (chart) Items with the most sitelinks Items with the most sitelinks, but no link to one Wikipedia (sample: Welsh Wikipedia, cywiki) Items with the fewest sitelinks Most linked wikis Items with the most identifier properties Items with no other statements Most recently created items Items with novalue claims Items with unknown value claims Usage history (total) Usage history (main statement) Chart by item creation date Database reports/Constraint violations/P4864 Map Random list
Proposal discussion	Proposal discussion
Current uses	Total 1,370 Main statement 1,368 99.9% of uses Qualifier 2 0.1% of uses
Search for values

[create Create a translatable help page (preferably in English) for this property to be included here]

Type “restriction enzyme (Q219715)”: item must contain property “subclass of (P279)” with classes “restriction enzyme (Q219715)” or their subclasses (defined using subclass of (P279)). (Help)

Exceptions are possible as rare values may exist. Exceptions can be specified using exception to constraint (P2303).
List of violations of this constraint: Database reports/Constraint violations/P4864#Type Q219715, SPARQL

Format “([ACGTRMWSYKHBDVN]*\^[ACGTRMWSYKHBDVN]*|(\(-?\d+\/-?\d+\))?[ACGTRMWSYKHBDVN]+\(-?\d+\/-?\d+\))”: value must be formatted using this pattern (PCRE syntax). (Help)

Exceptions are possible as rare values may exist. Exceptions can be specified using exception to constraint (P2303).
List of violations of this constraint: Database reports/Constraint violations/P4864#Format, SPARQL

Scope is as main value (Q54828448): the property must be used by specified way only (Help)

List of violations of this constraint: Database reports/Constraint violations/P4864#Scope, hourly updated report, SPARQL

Example SPAPQL query

You can search restriction enzymes which can recognize the sequence "ACTTGTCATGGCGACTGTCCAGCTTTGTGCCAGGAGCCTCGCAGGGGTTG", for instance, and its cutting site by using regex FILTER (modified from [1]).

SELECT DISTINCT ?enzyme ?enzymeLabel ?recognize ?cut
WHERE
{
  ?enzyme wdt:P31 wd:Q49695242;
          rdfs:label ?enzymeLabel;
          wdt:P4863 ?recognize;
          wdt:P4864 ?cut;
  FILTER (lang(?enzymeLabel) = "en") .
  FILTER regex ("ACTTGTCATGGCGACTGTCCAGCTTTGTGCCAGGAGCCTCGCAGGGGTTG", ?recognize) 
}

Try it!