Wikidata:Database reports/Constraint violations/Mandatory constraints/Violations

route map (P15): FormatEdit

image (P18): Commons linkEdit

place of birth (P19): Conflicts with instance of (P31)Edit

sex or gender (P21): Conflicts with located in the administrative territorial entity (P131)Edit

sex or gender (P21): Conflicts with instance of (P31)Edit

sex or gender (P21): Conflicts with original language of film or TV show (P364)Edit

sex or gender (P21): Conflicts with coordinate location (P625)Edit

sex or gender (P21): One ofEdit

mother (P25): Allowed qualifiersEdit

child (P40): Conflicts with instance of (P31)Edit

flag image (P41): FormatEdit

noble title (P97): Type human (Q5), legendary figure (Q13002315), fictional character (Q95074), narrative entity (Q21070598)Edit

occupation (P106): Conflicts with instance of (P31)Edit

home venue (P115): ContemporaryEdit

place of burial (P119): Conflicts with instance of (P31)Edit

located in the administrative territorial entity (P131): Conflicts with instance of (P31)Edit

logo image (P154): FormatEdit

followed by (P156): None ofEdit

seal image (P158): Commons linkEdit

developer (P178): ContemporaryEdit

doctoral advisor (P184): Value type human (Q5), fictional human (Q15632617)Edit

doctoral student (P185): Value type human (Q5), fictional human (Q15632617)Edit

adjacent station (P197): Item country (P17)Edit

adjacent station (P197): Type entry point (Q228332)Edit

VIAF ID (P214): Allowed qualifiersEdit

VIAF ID (P214): Conflicts with instance of (P31)Edit

ISO 639-1 code (P218): Item ISO 639-2 code (P219)Edit

ISO 639-1 code (P218): Item ISO 639-3 code (P220)Edit

ISO 639-2 code (P219): Item IETF language tag (P305)Edit

ISO 639-3 code (P220): Allowed qualifiersEdit

EC number (P232): Single valueEdit

canonical SMILES (P233): Allowed qualifiersEdit

ISSN (P236): FormatEdit

FAA airport code (P240): FormatEdit

FAA airport code (P240): Single valueEdit

COSPAR ID (P247): Conflicts with coordinate location (P625)Edit

CiNii author ID (books) (P271): FormatEdit

chemical formula (P274): Conflicts with general formula (P1673)Edit

GOST 7.75–97 code (P278): FormatEdit

postal code (P281): Conflicts with subclass of (P279)Edit

postal code (P281): Conflicts with instance of (P31)Edit

head coach (P286): Value type human (Q5)Edit

vessel class (P289): Type watercraft (Q1229765), vessel (Q16391167), fictional ship (Q16708006), fictional spacecraft (Q14637321)Edit

station code (P296): Conflicts with ESR station code (P2815)Edit

station code (P296): Conflicts with Gares & Connexions ID (P3104)Edit

station code (P296): Conflicts with UK railway station code (P4755)Edit

station code (P296): Conflicts with Amtrak station code (P4803)Edit

station code (P296): FormatEdit

ISO 3166-1 alpha-2 code (P297): Item ISO 3166-1 numeric code (P299)Edit

ISO 3166-1 alpha-3 code (P298): Item ISO 3166-1 alpha-2 code (P297)Edit

ISO 3166-1 numeric code (P299): Item ISO 3166-1 alpha-2 code (P297)Edit

ISO 3166-1 numeric code (P299): Single valueEdit

ISO 3166-2 code (P300): FormatEdit

IMDb ID (P345): Conflicts with instance of (P31)Edit

Joconde work ID (P347): Item collection (P195)Edit

RKDimages ID (P350): Item collection (P195)Edit

RKDimages ID (P350): Type work of art (Q838948), artwork series (Q15709879), book (Q571)Edit

Entrez Gene ID (P351): Single valueEdit

discography (P358): Unique valueEdit

part of (P361): Entity typesEdit

Sandbox-String (P370): ScopeEdit

  • Q65499045: Property:P370: ATGCCCGACGCCTCCTCTACCGCGGTGGTAGCCGCCCCTCCTTCCAAAGAGAGGTTGGGTAGCAGCGGAGGCGTGCTGCTACCGCTTGCCGTGGCCGGAGCTGGTCTGCTGTGCCTATGGAAGGCCTTCCAAATTTGCTCCGTTCCCGTTCACCCGCGTTGCGTGACCGTCGTCTACGACACGCGCCGCAAGACGGTCTTGTGCACCTCGGCGGATTGCGAGATGCGCCGGGGCTCACTGCCGCGGGTGTCTCACTTCAACGCGTCACTGTACTTCGGGTCCGCGCTGATGTACTGGAGCCGGACGCGGCTGCTGGTGCCGCCGTCGTCCTTCTTCGGCGTCTTCACGCTTCCGCGCAGCGTCCTCGAGGAGCCGGGCGAGCCCGTGAACTGTGCCGTGGAGGAGGTGGCCGTGCGCGACGGGTCCGTGAACATGATGGTGACTGTCTTCTACACCATCCCCTTCGACCAGGTGGAGCGCTACCTTGCCGCCGTCGGCCCTGAGCCACCGAACGAAGTAATCGGCAAGGCGGTCGCCTACGTTGCACGCGTGCGGTGCGCAGAGCAGTCGGCCGGTATCTTGCTCAGCAAGACCCGCCGCGAAGCGTTCATGGGTCCGTACAAGGACCACCTTACCTCGAAGCTCATGTCGGAGGCGGCGGTGCTGGTGAGGGACGTGGCTGTGGAGAGTGTGGTGCTGCTCGAGGGGGGCTAG
  • Q65500432: Property:P370: ATGGGCAACCAGCTTTTCCTCGTTGCAAATCTGTTAGCCACTGCGCACCGGACTGGCATCCCAGCCTACCTGGAGGCGGCGCCGTTCAGCAGCAGCGCCGAGGGCCCACGTCCCACCTACTGGGACACACTTTTTCGCGACCTCGGTCGTCACGGCGTACAGATGTGTGCGTCCTCGCCGCCGCTGCCTGTCGTGACGGTGCCCGAGACGCGACCCGTGCGGAAGGTGCGACTCGATGCGCAGCGGCCCTGCGCCTTCCACATGATCGGCTTCTTCCAAAGCGATGCCTTCTTCGACGACCACCCGATCATGTCCTCCGTCATCCCGCGGGAGCTGTGGGACTCGGCCCGCGAGCACCTGGCCACCTACTACGGCGGCGGGTCGTGCCACACTGTCGCCCTGCACGTGCGGCGTGGCGACTACACACGTTTTACCGACATCTTCGAGCAGCTCGACGTCGTCGAGTACTACGATGTGGCAGTGCGGCAGCTGCTTGGTGGCCTGCTCTTGCAGCCGCCTTCGCTGCTGCGGCCGCAGCAGTCATCGGTGGACTCGGCCCAAGCGCCGACTGCAGGCACACCGCCGCTGCTGCCGCTTCACTTGCTTGTCTTCTGCGACGAGGAGCGCTTTGGGCGCACCGTTGTGGGGTACTTCCGCACCAAGTACAAGGGTGCCGTGATGGTCAGCCTCGTGTGCGCCGCGACGGAGGCAAGCGCGATATGGGCGAGGCCAACCGCGTCGTCGCCGTCAGTGCCGATAATGCCGCGTGATGTACTGGAGTTGCTGATGATGTCGCAGTGCAACGACGTCGTGATGGCAAACTCGACCTTCTCGTGGTGGGGCGCCTACCTGAACCGCGTCTCACTGCGCCGTGTCATCGCACCGTCCCGGTGGTTCGTGAAGGATCCGTACCCGGCGTCAAATCACCTCTACTGCCCTGGATGGATACTCATCTGA
  • Q65500958: Property:P370: ATGCTGCCGTTTTCTTACCGAGTGCTCATGCGCGGCGTATCGGCGGTGGCCGGTGCGTCGTCCGTGGCTCTGCAGCATCGCGCGCTGGCGGGGACGACGCGCTCGTTCAGCAGCAGCAGCCTGGTGTGGTTGGCGCCAGCCGCGCCGACAACGCAGACGCCGCCGGCGATGGGCGGCGATACGGACGCTGAGGAGACGCACCCTGATTTTCAGCCCCGCATGGTATCCAGCGACCTCGCGCAGGACGAGATCGCCATGATCAAGAAGGATATAGACGACACAATCCGCGATGAGGACATTGTCGTGTTCATCAAGGGCGTTCCGGAGGCGCCAATGTGCGCCTTCTCGAAGCGCATGATTGACGTGATGGAGGCGCTTGGGGTGGAGTACACCTCATTCGACGTGCTCGCTCACCCGGTGGTGCGCAGCTACGTGAAGGAGGTGAGCGAGTGGCCGACGATCCCGCAGTTGTTTGTGAAGGGTGAGTTTGCCGGCGGCGTCGACATCATCCTGAAGATGGCGGAGGGCGGCGACTTGCAGATGCTGCTGGATCAGAAGGGCATCAAGCATCGTGATACCAAACCGTAG
  • Q65516655: Property:P370: ATGGCACTAACGCAGTCTTCTGGTGCGCCGCTGCGCAGTGTGCAAGGCGGCGTAGGAGATGCATCGTACGCGGATGGGGCCGGGCGGGCGCCCGGGCGCGTCAACGGGGCCTCCGCGACACCGCTGCTGACGGAGGAGGCGGTGCAGAGCAGCATTGAGACTTTCGAGGATGCGGCCTGGGTGCGGGAAGAGGCAGTGCGCAGCTACGCAGAGTTCCACAACAACGTCGAGTCGCTGCACGCAACCATGCGCACGCAACTTCGGCCTGTGTGGCGGACAGCGATGCAGCTGCGCCCTGACATCCTCGCGGATGTGCGAGACGAGTGGCGCCTCCGCCGACGTGACAGCATTCCAGACGGCATCCCGATCCCTGCCGCCGCCGCGCAGCACATCGCGCTGCAGGAGACCATACTGAGTGAAGTGGAGGACACGCTGCAGGTGCTGCGCAACACGTCGGTCCGCTTCGCCGCGCATTTCTTGTCGGATGAGGAGAAGATCTCCATGGGCGCAAACCCCGCGTACCTGCGCGCGCCGGACATAGACAAGGAAGTGGTGGTGTCGCGCTCGCAGAGCACTTCCACCTCGCCACAGCGCGCGCTGCCAGCCAGTGTGATGTCAGTTTCCTCGTCTGCAGGAGCTGTGGCGAGTGCCCACATAAAGCCTTCCGCGTCTAGTGCTGCTACTGCTGCCGTCCACACAACACGTGAGGGACACAGTCGTCGCCACCAGGGCAGCCATGCGCAGCACCACCACCACCACAACGACGACGAAGCGGGACTGGTGAGCTCCAGCTCGAACCGGCACGTGCACAGTGGCAAGTCCTCCTGTGCGAGCCGGGGCGCCGGCGACGATCCGCTGTTGGAGGAGTTGCGCAAGCAGTATCAGCTGCGCATTAGGGAACTGAAGGCGCAGTGTGAGGCGGGAGCAAGCCGTCGAAGCGAGCACGGTGCATCGCGATCAGCGGCGGCGACGCCACCGCGGCGCGGTAATCGGGCACGCGTCGCAGCGTCGAGATCATCGTCTCTACCTTCGAGGGCTTCATCGGCGTCTGCGAGTGTATTGACCAGCTCCAGCTCGACAGTGTCGCGTCGCTGA
  • Q65516997: Property:P370: ATGAAGATCACCGTTCACGTGCGAGAGAAGATCATACCGCTGCAGTGCGGCGATGGCACGCAGCAGGTGGTGTGGCTCGGTAACGCAGCCATGATACACTACGACGCTTCCTTTGGCAAGCGCTTCGGCCCGCCGGTGTCGATCCGAAAAGAGGGCGGCGTGCAGTGCGACTTTGAGGCCCGCGTGTGCGACGTGCTGGAGGATGGCCAGCACGTATTTGTGACCCTCGAGAGCGACAGGGGGCAGTAA
  • Q65517494: Property:P370: ATGGCTCTGCCGGGCGTATCACATTATGAGCGCCTGCCCACGCGTACCAAGATTCAGTTCTTCTGGATCTCCATGCTGACGATGGGCTTCGCGTACCAGTTTCTCAAGATGACGGTGCTGCGCGTGCAGCCGAAGCGAGAGGAACAGATGTACATGCACATCCGAAAGGTGTACGGCGACAACATTCCGGAGGAGCTGCTGCAGCGAGCGAAGCGCCAGCGCGAAGCTCAGGATGCGCTGACGCTGACGAACATGCTGCGCACCCCTACACCGGGCCAGACGTCGAACGCGCTGCAGAACGATCTCGACCCTCGAGCCCTCATCAAACTCAAGAGCTGGAACGGGCATTAG
  • Q65517916: Property:P370: ATGTCCGTTGCCTTGGAGTCGCTTCTGCACCGATCCGTGTGCTGCCACCTGGCACACGGTGAGGAGTACCGAGGCCAGCTGGAGGCCCTGGACGGCACCTTCGATGTGGTCCTGTCGCAGTGCACGCGGAGCCGCGCCGCCCCAAGGCAGCCGGCCGAGCCCCTCGTTTTTCTGCGCGGCGAGAACATCATCTACATCGGCTTCGACGAGTCGTCCAGAAGTGAGGACGGGACCACCGCGTGA
  • Q65518515: Property:P370: ATGGGAGGCTGCTGCGGGGTCGCCTCAGAGGCAGGCACGGCCTCGTACAACGACACGGTCTCTTCCACACCATTTCCACCACCGTCACGTCGCGGAAGGTGGCGGGGCTCAACAAGAAGCACCAGCAAGAACGAAAAAGCAGCGCTTAAGAGGAGTGGTAGGCTCGAGTCCGCGCCGTCGTTCCTGGGCAAGATACTACCGCTGAAGGATCGAGGTGACACCGACAGCGCTCCTACCCGCGGCACCGCCGTCGATGCCGTTCCCTCGGCCGCCCCTTTGAAGCTCAGCGATTACGCCACTCTCGCCGCCCCCGAACATGACCAGGACCTGCCTTTCAAAGCCACACCACAGCACGGCGCCAACGGCAGCAGCCCTGACCCGCTCCTGCCTGACCTGTTTTACATCTCCGCTTCCTCGTCCTCATCGCTTCTCGCGAACTGCGACGTGGACGATAGCGCTGAGGACGGCGTTGGCGCCCGTCTTGACGGTGAAGGGCAGAGCTCGCTGGTGGAGGTGAGCCAGCCAACGCAGAGCTTCGCAGGTGATGTGCACACGTACTCGGAGCTGGACTTGACGAGCGAGTGGGAGCCGCCGTCGTTCGATCGCCTTGGCCGGCGGTCGGAGCGTCTGGGCCGCAACGGAACGGACCGCAGCCGACTGCGTCAGCTGATCGTCCGCGAGGCCGAGGTGCGCGCGTCCCTGACGGTCATGTACGTGCATCAGCATCAGCGGTTTTCGCTGAACCTCGCCAAGGAGCACTTCATCGCGGTATACATTAGAATGCGGCAGGAGTACGAGTCGGAGTGGACGGTGCAGTGCATCTGCTGGATCGTTGCGGTAGAGAGTGTCATGCGGGAAGCGCTGGCACGCGAGTGGTGGACGGAGCGAGCCGCTTTAGTGCGCCGAGTCGGGTCTCTCAGGACGCCACCGCCACCACCACTGCGGCCGACGTGCGACGACGCGAGGCTGGGTATCACAGCCATTCACGCACTGAAGCGAGAGGACAGCTTGCCTTACGTATCGAACTTGTACACGGCCGCGGACTTGACCTCCAGCGAGGAGGCAGAGGAGGGCGACCCGCTGAACCTGTGCATCCCGCCCATGCGCGCCTCTTCCTCAATCGCCCTCTTCTCCCCACCGCTGCAGCAGCAGCTCTCGGTGCTTGGCGGATCGCGATCTGCCTCTGCAGGAGTGTCTCGCGGCCTTCGCTCGGCTTCTCGAGTTAGCGCACCACATGCCTCGTCTTTTGTGTCGTCGCCAGCATCGGCCCTTTACTCGCCTGTGCCGACGAAGCGCGTAGCCGCTGCGCAGCAGGCACAGAAGGGCAGGTTCGTGCGGGGGCGGAGCATGGCTGTTACCGAGGCGCTCCTGTGA
  • Q65521701: Property:P370: ATGTACAACGGTGTGGAAGCTGCCGCGGTCAAGGGTACCGGGCTGAGTGGCTATGTTCAGCGCAGCCGCGTGAACGTGTTGGCGACGGGCCGCGTGCCTGCCGAGGAGGGCGCGGCGGCGATGGAGGGCGGGGCGTCCATCAACCCCCTCGAGCAGCGCCGCGCACAGGGCGAGAACCGCGAGATGGCGGCACGGCTTGAGTCTCATCGCGCCTTGCGTGAGGTGCGACTGCGCGTCATGCTCTACCGTGAGGAGCGCGAGGCGGCCGGGGTGGACCCCGTCACAATGGACCGCGAGTGCGGCGAGCTCTACGACTCCTTGCTCGTCGCCGCCAAGCGCCGGCTGAAGGCGCAGCAGAAGACTGAGAACGCCAAGACAGTCGCTAAGTTCGCCGCCGCGTTCGGCGTGAAGGCCACGGCAGCGGTGACCACCTCAGGTGGTGGTGCAGGTAGCGGCAGCGCCTTCGACCGCTCCGTGCAGGAGGTGGAGAAGCACCGCACCGAGGAAGAGCGCCGCCGTCACCAGGAGGCGCAGCTCGTCGAGCACCTGAAGCGTATGCGCCGCGAGGGCAGCGACGCAGTAGAGGGTGCGAACATCTGCGACACAGAGGAGACAGGGATTTAG
  • Q65643840: Property:P370: ATGTACCGCACGGCGCCTCAGATTCTCTTTCAGTTTGTGGGTGGCCTGAGCATCACCCAGTACACCTACCCCATCCTCTACGACGCCTTCACTGGCGAGAAGACCGGTGCCCATGCCGCCACTATCACCACGTCCAGCAGCAGCGGCAGCTTCTCGGGGCTGTGGGGCAGCTTGAAGTGGAGCTTTCAAGCCCCTCCAGTGGATCACACCCTCACAGACGACATCGAGGAACTCCTGCGCACCCACTACTGGCTCGCGTCCGCAGTCCTGTCGCTCACGGTAGTGTCTGGCGGCGCGCCAGCGCTGCTAGGGAGCGGGCTCAGCGTGTACTGCAACGGCGGCCCCGAGGGCAAGGCCCGCTACTCCCTGCTGAAGCAGCGGCTTCGCAACTTCTCCGAGAATGGCAATCACGCATAA
  • Q65645685: Property:P370: ATGCCTCAAAATGCGGCGCAGCTGAACCGGATGCAGATTCGTGAGCAGGAGGCGCTCAACCGGCAGCGCCGCATGCAGGACGACGCGGTGGCACGGCGCGAGGAGGAGGAACTGCGGCGGACAAAGGCCCAATACGACCACGTCAGCTCGCACGGCTACGGACGAGCTGGCAGTGGTGCCGCTGCGCCGAGTGGCAGCCGTGGCGCATCCGACGAGGTGCAGATTCGCGTGTACGTGCGGGAGTGCGACGAGGAGGCGAGCCGGTCCTTCAGCTACCGAGAGGATACCGCTGCTAACTCCACCTCCCACATAGGTCCGCGTTCCGGTGCGTCTGCATCCACGTCGGCCGCTTCGCATGTCGCCAGACGTGGTGTCAACGGCGCGCTGCCACCGATTGGCTCGTCGGGGCGTCTTGGGCCACCGCGCGCGCCAGGGGCCCGTGCGGCGTCCGGCGGTGGTGGCGGCACTTCGGACATCTCAGGTGGTGCGGCATCATGTGGGGTGGTCGCACCGAACCGGGCACGGGTTCCTCGATACCTGCAGCAACGCAAGGCAGAGCTGGCGGCAGAGAAGGAGGCGATCGCCGCAGAGGCGGAGAAGCAGCGGCAACTTTCTCTCATCCCTGCTGGTCAGCGCCGCGTTTCGGAGGAGGAGAAGGCAGACACCCTGCGCCAGCTGGACGAGCGGCAGCAGGAGCTGGAGGGACAGCTGGCCCGCATTCCCATCCGCTTCGACACGCAGTCGATCCAGCAGCGGCGGCGCGCCATCGAGGAGGAACTGCGGCAGATCGAGACGACACGCAACAAGTACAACACCAAAGGGACTCTCTTCATGCCGCTGTGCTAG
  • Q65924744: Property:P370: ATGCGGCGCCTCTTCCTGCTGCTGGCATGGCAGCCATCCTTTGTCAAGCATCTCTCGGAACTGGAGCCGGCGCCGCAGAGAGCGCCCGTAGAGAAGCGACGTAGACAACATATCCCGCTCTCTCTGCAGGCACGCGAGGAGCTGTCCCGCAAGTCGAATGAGCTGCAGTACCATGTCGTCACGCAGGACTGGTTCGGCCAGCGCGTGGATGACTTCGTTATGCAGCACCACCCGGAGTGGGACTACGAGACGGTGAAGCGGCTGGTGCAGCAGGGGCACATCTACCGCTACCGGAAAAACGGAAAGAAGCGATACACGCGGCTGACGGATCGTCTGGAGTTCGATGAGCTTGTCGTCGTGCCGACAGCGAGCTTCTGGGAACGCCAGCTGGCGCCGCCGAGCGGGGTGGAGCTGCAGAGCTCCTCGACGTCGCAGCAGCAGGAGCGGCGGCAGAAGTTTCACCTCTCCGCCAAGACGCGCGAGATGGCGCAGGAGATGGTGCTCTTCAAGAACGAGCACGTCATCGTGATCAACAAGCCGAGCGGCGTGCCGATCATGCCGACGCACGACCCTCTTGCCATGAACATCACAGACCTCCTTCCGGCGTGGCGGTACACTAATACGCAAAAACCGGTCATATGCCACAACCTTGACACCGAGACGAGCGGGTGCGTGGTGCTGGCGCGCAGTGCGAACGCGCACCGCATGCTGGGCCGCATGTTTGTGAAGCGTGTAGTGCCGAACAGCGTGTACTGGGGTTTCGCGGTAGGGAAGCCGCCAGTGAATTTCGGCCGCATTCGCATGCACTTCGAGATTCAGAAGGGGCAGGGCGGCGATGTCATTGTTGCTCGCCCCACCCCCACCGCAGACTCCAAGGTAGGCATCGCCGAGTTCGTTGTGAATGCCTCCGCGCTGGAGTTCGGCAGCTTCATCTCCTTTTACCCACTGACGACGCGGCGGCATCAGGAGCGCATTATGGCCGCCCACGCGCTGCGAGCCCCGCTCCTTGGCGACGCGAAGTATGGTGGCGAGAGCGCCTTCCCGCACTCCCTGTCGCTCTTCTGGGACCCCGCCCGCAAAGACGTCCCACTGCACCTCCATCACCGCAAGATTCAGCTCCCCTACAAGAACGGCGCCGGTGAGTTTGTGTGCGTCACGGCGCCGCTGCCGCCGCACATGGAGAAGACGTTCAAGCGGTTGGGGTGGCCAGTCGACGCTGATGACCCACTTATCCCTGGTTGA
  • Q65924753: Property:P370: ATGTCCACATACGACAAATCAGATCAGATCGGCTATGATGAGACGGATAATACGTTGAATGCCGAGCTGGAAGAAATGATGGCGCGCACCCCACCGGAGGTGCAGCGCCACCTGCAGCACCGCATTCATGATGGCATCCTGCAGCGCATGAAAGAGGAGACGACACGCAAGTGCATTACGTTCATCCAAAAGTATGAGCAGTGTGTGAACAGCCAAAAGCCGTACAACATGAAGCTATGCTATCCCCACCGGGATGCTATGAATGGGTGCGCGCAGGAGGTTAACCGGGAGGAAAACTACCAACGTTACCGCATCATGTACCTCCGTGGCGAGCTGCTTAGGTACCATGAGAAACGTATTGCCGGCAAGATGGAGGCATTCAAGGTGAAGGCTCCCGACGCGATCCGTGGGTGGAAGCACGACTACGCACCCAAGTATATGCACATGATGGAGGATTTGGGGGCGGCGCCTCTCGGCAATGCCGTGGGGACGGCGGAGGAAACCACAAACTCGAAGTAG
  • Q65924767: Property:P370: ATGGCCCGTGGCAACCAGCGTGATCTCGCGCGGGAGAAGAACATGAAGAAGCAGCAGCAGAAGAACAAAGGTCACCGCGAGGACGGTCTTTCCCACGCTGCGCGCAGAGAGGCGGATGCCGAGGCGATGCGTCTGAAGCAGGCCGCTGCTGCGGAGCGGAAGGCTGCCGGAGGCTCGTGA

INSEE municipality code (P374): Item located in the administrative territorial entity (P131)Edit

space launch vehicle (P375): Single valueEdit

Mérimée ID (P380): Item located in the administrative territorial entity (P131)Edit

Mérimée ID (P380): Item country (P17) = France (Q142)Edit

PCP reference number (P381): Item located in the administrative territorial entity (P131)Edit

PCP reference number (P381): Item heritage designation (P1435) one of class A Swiss cultural property of national significance (Q8274529), class B Swiss cultural property of regional significance (Q12126757)Edit

CBS municipality code (P382): Item located in the administrative territorial entity (P131)Edit

CBS municipality code (P382): Item country (P17) one of Netherlands (Q55), Kingdom of the Netherlands (Q29999)Edit

CBS municipality code (P382): Item coordinate location (P625)Edit

CBS municipality code (P382): Unique valueEdit

soundtrack release (P406): Type work (Q386724), group of works (Q17489659)Edit

Libraries Australia ID (P409): FormatEdit

Libraries Australia ID (P409): Unique valueEdit

military rank (P410): ContemporaryEdit

voice type (P412): Type human (Q5), fictional character (Q95074), role (Q1707847)Edit

position played on team / speciality (P413): Type human (Q5), fictional human (Q15632617)Edit

field of this occupation (P425): Conflicts with industry (P452)Edit

taxonomic type (P427): Value type taxon (Q16521), type (Q3707858)Edit

dantai code (P429): Item located in the administrative territorial entity (P131)Edit

dantai code (P429): Single valueEdit

German municipality key (P439): FormatEdit

German municipality key (P439): Type municipality of Germany (Q262166), unincorporated area in Germany (Q15974311)Edit

German district key (P440): Item located in the administrative territorial entity (P131)Edit

German district key (P440): Item country (P17) = Germany (Q183)Edit

German district key (P440): Item coordinate location (P625)Edit

China administrative division code (P442): FormatEdit

astronaut mission (P450): InverseEdit

astronaut mission (P450): Value type manned spacecraft (Q7217761), spaceflight (Q5916), fictional spacecraft (Q14637321)Edit

Emporis building ID (P455): FormatEdit

Emporis building ID (P455): Type architectural structure (Q811979), statue (Q179700)Edit

sRGB color hex triplet (P465): FormatEdit

Eight Banner register (P470): Single valueEdit

country calling code (P474): FormatEdit

FilmAffinity ID (P480): Single valueEdit

FilmAffinity ID (P480): Unique valueEdit

OMIM ID (P492): FormatEdit

ISO 4217 code (P498): FormatEdit

HURDAT identifier (P502): FormatEdit

HURDAT identifier (P502): Unique valueEdit

BNCF Thesaurus ID (P508): FormatEdit

academic degree (P512): Type human (Q5), fictional character (Q95074), person (Q215627)Edit

Find A Grave memorial ID (P535): FormatEdit

Find A Grave memorial ID (P535): Type person (Q215627), conjoined twins (Q216866), horse (Q726), animal (Q729), pig (Q787), orca (Q26843), Gorilla (Q36611), horned lizard (Q288720), Pan troglodytes (Q4126704), group of humans (Q16334295), cenotaph (Q321053), fictional human (Q15632617), memorial (Q5003624)Edit

Find A Grave memorial ID (P535): Unique valueEdit

office contested (P541): ContemporaryEdit

officially opened by (P542): Target required claim sex or gender (P21)Edit

officially opened by (P542): Value type human (Q5)Edit

version type (P548): ScopeEdit

public username (P554): ScopeEdit

doubles record (P555): Single valueEdit

crystal system (P556): One ofEdit

crystal system (P556): Value type crystal system (Q898786)Edit

singles record (P564): Single valueEdit

basionym (P566): Single valueEdit

publication date (P577): Conflicts with instance of (P31)Edit

IPNI author ID (P586): Type human (Q5)Edit

MMSI (P587): Single valueEdit

MMSI (P587): Type watercraft (Q1229765), radio communication station (Q1474493), sea mark (Q7321258), Maritime Rescue Coordination Centre (Q56885501)Edit

point group (P589): One ofEdit

GNIS ID (P590): FormatEdit

ChEMBL ID (P592): Single valueEdit

MedlinePlus ID (P604): FormatEdit

conflict (P607): Conflicts with instance of (P31)Edit

mother house (P612): Type monastery (Q44613)Edit

OS grid reference (P613): Item country (P17) one of United Kingdom (Q145), Isle of Man (Q9676), Guernsey (Q25230), Kingdom of England (Q179876)Edit

UTC date of spacecraft launch (P619): Single valueEdit

time of spacecraft orbit decay (P621): Type spacecraft (Q40218)Edit

cultural properties of Belarus reference number (P632): FormatEdit

cultural properties of Belarus reference number (P632): Single valueEdit

ISTAT ID (P635): FormatEdit

ISTAT ID (P635): Single valueEdit

Léonore ID (P640): FormatEdit

Léonore ID (P640): Item sex or gender (P21)Edit

Léonore ID (P640): Item date of birth (P569)Edit

Léonore ID (P640): Unique valueEdit

Freebase ID (P646): Conflicts with instance of (P31)Edit

drafted by (P647): Value type sports organization (Q4438121)Edit

Biografisch Portaal van Nederland ID (P651): Type human (Q5), group of humans (Q16334295), fictional human (Q15632617)Edit

Biografisch Portaal van Nederland ID (P651): Unique valueEdit

RTECS number (P657): FormatEdit

Mouse Genome Informatics ID (P671): Unique valueEdit

eMedicine ID (P673): FormatEdit

ÚSOP code (P677): Type natural monument (Q23790), protected area (Q473972), remarkable tree (Q811534)Edit

ZVG number (P679): Unique valueEdit

NCBI taxonomy ID (P685): Single valueEdit

BHL Page ID (P687): FormatEdit

replaced synonym (for nom. nov.) (P694): Value type taxon (Q16521), scientific name, published under a Code of nomenclature (Q23729754), scientific name (Q10753560)Edit

PubMed ID (P698): Allowed qualifiersEdit

PubMed ID (P698): Conflicts with instance of (P31)Edit

PubMed ID (P698): Conflicts with found in taxon (P703)Edit

Strunz 8th edition (series ID, updated) (P711): FormatEdit

Strunz 8th edition (series ID, updated) (P711): Single valueEdit

Nickel-Strunz '10th ed', review of (9th ed/ 2009 update) (P713): Item IMA status and/or rank (P579)Edit

JPL Small-Body Database ID (P716): Single valueEdit

Canmore ID (P718): Unique valueEdit

OKATO ID (P721): Allowed qualifiersEdit

OKATO ID (P721): FormatEdit

Digitale Bibliotheek voor de Nederlandse Letteren author ID (P723): Unique valueEdit

Internet Archive ID (P724): FormatEdit

service retirement (P730): Conflicts with instance of (P31)Edit

family name (P734): Conflicts with instance of (P31)Edit

pseudonym (P742): FormatEdit

  • Q353758: Joan Almirall, Rosa María Almirall, Clifford Brawn, Clifford Brown Jr., Clifford Brown, Juan G. Cabral, Betty Carter, Candy Coster, Terry De Corsia, Rick Deconinck, Raymond Dubois, Chuck Evans, Toni Falt, Dennis Farnon, Jess Franck, J. Franco, James Franco, Jesse Franco, Jess Franco
  • Q353758: A.M. Frank, Adolf M. Frank, Antón Martín Frank, Jeff Frank, Wolfgang Frank, James Gardner, Manfred Gregor, Jack Griffin, Robert Griffin, Lennie Hayden, Frank Hollman, Frank Hollmann, Frarik Hollmann, B.F. Johnson, J.P. Johnson, Yogourtu Ungue, James Lee Johnson, James P. Johnson
  • Q353758: David J. Khune, D. Khunne Jr., D. Khunne, David J. Khunne, David Khunne, David Kuhne, David Kunne, David Kühne, Lulu Laverne, Lulú Laverne, Franco Manera, J. Franck Manera, J. Frank Manera, Jesús Manera, Jeff Manner, Roland Marceignac
  • Q353758: A.L. Mariaux, A.L. Marioux, John O'Hara, Cole Polly, Preston Quaid, P. Querut, Dan L. Simon, Dan Simon, Dave Tough, Pablo Villa, Joan Vincent, Robert Zinnermann
  • Q63644859: Ка—ров; К—ров, М. А.; Каров, М. А.; М. А. Каров; Мак—Ар; Макар; Менакер; Неон; Спартак; Шева—бен—Бихри; Rosch—Lokisch

pseudonym (P742): Type human (Q5), fictional character (Q95074), group of humans (Q16334295), individual animal (Q26401003)Edit

Lake ID (Sweden) (P761): Item coordinate location (P625)Edit

Lake ID (Sweden) (P761): Single valueEdit

Lake ID (Sweden) (P761): Type body of water (Q15324), waterbody (Q1389310)Edit

Czech cultural heritage ID (P762): Item country (P17) = Czech Republic (Q213)Edit

Czech cultural heritage ID (P762): Unique valueEdit

Swiss municipality code (P771): Item locator map image (P242)Edit

INE municipality code (P772): Single valueEdit

INE municipality code (P772): Unique valueEdit

Swedish urban area code (P775): Unique valueEdit

Church of Sweden parish code (P778): Item Swedish National Archive ID (P5324)Edit

Church of Sweden Pastoratskod (P779): Single valueEdit

LAU (P782): Single valueEdit

spore print color (P787): One ofEdit

International Standard Identifier for Libraries (P791): Conflicts with Mérimée ID (P380)Edit

International Standard Identifier for Libraries (P791): FormatEdit

International Standard Identifier for Libraries (P791): Unique valueEdit

located on linear feature (P795): Value type railway line (Q728937), road (Q34442), transport network (Q924286), watercourse (Q355304), canal (Q12284)Edit

student (P802): Value type human (Q5), fictional character (Q95074), Primates (Q7380)Edit

Italian cadastre code (P806): FormatEdit

Italian cadastre code (P806): Single valueEdit

IUCN protected areas category (P814): One ofEdit

CGNDB Unique ID (P821): Item located in the administrative territorial entity (P131)Edit

CERO rating (P853): Type video game (Q7889), expansion pack (Q209163), video game compilation (Q16070115)Edit

BMLO ID (P865): Unique valueEdit

State Water Register Code (Russia) (P884): Single valueEdit

State Water Register Code (Russia) (P884): Type body of water (Q15324)Edit

FIPS 10-4 (countries and regions) (P901): Unique valueEdit

PORT film ID (P905): Unique valueEdit

PEGI rating (P908): One ofEdit

PEGI rating (P908): Type video game (Q7889), expansion pack (Q209163), video game compilation (Q16070115), video game remake (Q4393107), software (Q7397)Edit

USK rating (P914): Type video game (Q7889), expansion pack (Q209163), video game compilation (Q16070115), mobile app (Q620615), software (Q7397)Edit

filming location (P915): Item instance of (P31)Edit

LEM ID (P920): FormatEdit

FishBase species ID (P938): Unique valueEdit

ISIN (P946): FormatEdit

RSL ID (person) (P947): Allowed qualifiersEdit

RSL ID (person) (P947): FormatEdit

MycoBank taxon name ID (P962): Single valueEdit

MycoBank taxon name ID (P962): Unique valueEdit

Austrian municipality key (P964): Item instance of (P31) one of district of Vienna (Q261023), statutory city of Austria (Q262882), municipality of Austria (Q667509)Edit

e-mail address (P968): FormatEdit

category combines topics (P971): Type Wikimedia category (Q4167836)Edit

MusicBrainz area ID (P982): Conflicts with MusicBrainz place ID (P1004)Edit

MusicBrainz area ID (P982): Conflicts with MusicBrainz label ID (P966)Edit

Philippine Standard Geographic Code (P988): Unique valueEdit

record held (P1000): ScopeEdit

Nationale Thesaurus voor Auteurs ID (P1006): FormatEdit

Vatican Library ID (P1017): FormatEdit

Vatican Library ID (P1017): Unique valueEdit

legal citation of this text (P1031): Unique valueEdit

Sycomore ID (P1045): Unique valueEdit

Catholic Hierarchy person ID (P1047): Unique valueEdit

NCL ID (P1048): FormatEdit

PSH ID (P1051): Conflicts with instance of (P31)Edit

NLM Unique ID (P1055): Unique valueEdit

CVR number (P1059): Item instance of (P31)Edit

Thailand central administrative unit code (P1067): Single valueEdit

rector (P1075): Conflicts with instance of (P31)Edit

rector (P1075): Value type person (Q215627), fictional human (Q15632617), fictional humanoid (Q28020127), fictional character (Q95074)Edit

ICTV virus ID (P1076): FormatEdit

KOATUU identifier (P1077): Item country (P17) = Ukraine (Q212)Edit

population (P1082): Conflicts with point in time (P585)Edit

population (P1082): IntegerEdit

population (P1082): RangeEdit

maximum capacity (P1083): IntegerEdit

EUL editions (P1084): FormatEdit

Mohs' hardness (P1088): RangeEdit

redshift (P1090): Type astronomical object (Q6999), celestial event (Q751989)Edit

gross tonnage (P1093): UnitsEdit

orbital eccentricity (P1096): RangeEdit

orbital eccentricity (P1096): Type astronomical object (Q6999), spacecraft (Q40218), fictional astronomical object (Q15831598)Edit

floors above ground (P1101): RangeEdit

floors above ground (P1101): UnitsEdit

number of platform tracks (P1103): RangeEdit

number of platform tracks (P1103): Type transportation stop (Q548662)Edit

number of episodes (P1113): IntegerEdit

number of episodes (P1113): UnitsEdit

number of participants (P1132): IntegerEdit

floors below ground (P1139): Type construction (Q811430)Edit

topic's main Wikimedia portal (P1151): Conflicts with instance of (P31)Edit

topic's main Wikimedia portal (P1151): InverseEdit

topic's main Wikimedia portal (P1151): Value type Wikimedia portal (Q4663903)Edit

Scopus EID (P1154): FormatEdit

US Congress Bio ID (P1157): Single valueEdit

CODEN (P1159): Type periodical (Q1002697)Edit

municipality code (Denmark) (P1168): Item located in the administrative territorial entity (P131) one of Southern Denmark (Q26061), North Denmark Region (Q26067), Capital Region of Denmark (Q26073), Central Denmark Region (Q26586), Region Zealand (Q26589)Edit

municipality code (Denmark) (P1168): Item list of monuments (P1456)Edit

municipality code (Denmark) (P1168): Item instance of (P31) = municipality of Denmark (Q2177636)Edit

municipality code (Denmark) (P1168): Item topic's main category (P910)Edit

Rodovid ID (P1185): Single valueEdit

Rodovid ID (P1185): Type person (Q215627), fictional character (Q95074), narrative entity (Q21070598)Edit

MEP directory ID (P1186): Unique valueEdit

bodies of water basin category (P1200): Single valueEdit

bodies of water basin category (P1200): Type body of water (Q15324)Edit

bodies of water basin category (P1200): Unique valueEdit

bodies of water basin category (P1200): Value type Wikimedia category (Q4167836)Edit

Wikimedia portal's main topic (P1204): Type Wikimedia portal (Q4663903)Edit

Wikimedia portal's main topic (P1204): Unique valueEdit

Riksdagen person-ID (P1214): Single valueEdit

apparent magnitude (P1215): Type astronomical object (Q6999)Edit

Internet Broadway Database show ID (P1219): FormatEdit

U.S. National Archives Identifier (P1225): FormatEdit

Openpolis ID (P1229): FormatEdit

JSTOR journal code (P1230): Type periodical (Q1002697)Edit

Box Office Mojo film ID (P1237): Single valueEdit

OmegaWiki Defined Meaning (P1245): FormatEdit

OmegaWiki Defined Meaning (P1245): Unique valueEdit

patent number (P1246): FormatEdit

KulturNav-ID (P1248): FormatEdit

KulturNav-ID (P1248): Unique valueEdit

Swedish Open Cultural Heritage URI (P1260): FormatEdit

Rundata (P1261): Unique valueEdit

NNDB people ID (P1263): FormatEdit

NNDB people ID (P1263): Single valueEdit

facet of (P1269): Entity typesEdit

CANTIC ID (P1273): FormatEdit

Dictionnaire du Jura ID (P1276): Single valueEdit

Legal Entity Identifier (P1278): Unique valueEdit

OSM tag or key (P1282): Conflicts with coordinate location (P625)Edit

OSM tag or key (P1282): FormatEdit

filmography (P1283): Allowed qualifiersEdit

godparent (P1290): Value type human (Q5), fictional human (Q15632617), narrative entity (Q21070598)Edit

Association Authors of Switzerland ID (P1291): Item country of citizenship (P27)Edit

DNB editions (P1292): FormatEdit

number of elevators (P1301): IntegerEdit

number of elevators (P1301): Type geographical object (Q618123), geographic location (Q2221906), vessel (Q16391167)Edit

instrument (P1303): Type human (Q5), fictional character (Q95074), group of humans (Q16334295), instrumentalist (Q1278335), house cat (Q146)Edit

Swiss parliament ID (P1307): Unique valueEdit

EGAXA ID (P1309): FormatEdit

EGAXA ID (P1309): Unique valueEdit

has facet polytope (P1312): Type polytope (Q747980)Edit

OpenCorporates ID (P1320): Unique valueEdit

MusicBrainz instrument ID (P1330): Single valueEdit

MusicBrainz instrument ID (P1330): Unique valueEdit

PACE member ID (P1331): Single valueEdit

coordinates of northernmost point (P1332): Single valueEdit

coordinates of southernmost point (P1333): Single valueEdit

coordinates of easternmost point (P1334): Single valueEdit

coordinates of westernmost point (P1335): Single valueEdit

territory claimed by (P1336): Type geographical object (Q618123), geographic location (Q2221906)Edit

Italian Chamber of Deputies dati ID (P1341): FormatEdit

Italian Chamber of Deputies dati ID (P1341): Single valueEdit