Open main menu

Wikidata:Database reports/Constraint violations/Mandatory constraints/Violations

Contents

head of government (P6): ContemporaryEdit

video (P10): Allowed qualifiersEdit

traffic sign (P14): Item country (P17)Edit

image (P18): Commons linkEdit

place of birth (P19): Conflicts with instance of (P31)Edit

sex or gender (P21): Conflicts with located in the administrative territorial entity (P131)Edit

sex or gender (P21): Conflicts with instance of (P31)Edit

sex or gender (P21): Conflicts with original language of film or TV show (P364)Edit

sex or gender (P21): Conflicts with coordinate location (P625)Edit

sex or gender (P21): One ofEdit

father (P22): Conflicts with instance of (P31)Edit

mother (P25): Allowed qualifiersEdit

mother (P25): Conflicts with instance of (P31)Edit

continent (P30): Conflicts with instance of (P31)Edit

continent (P30): One ofEdit

instance of (P31): None ofEdit

child (P40): Conflicts with instance of (P31)Edit

flag image (P41): Commons linkEdit

flag image (P41): FormatEdit

screenwriter (P58): Conflicts with instance of (P31)Edit

architect (P84): Value type human (Q5), group of humans (Q16334295)Edit

librettist (P87): Value type human (Q5), fictional human (Q15632617), group of humans (Q16334295)Edit

sexual orientation (P91): Value type sexual orientation (Q17888)Edit

noble title (P97): Type human (Q5), legendary figure (Q13002315), fictional character (Q95074), character that may be fictional (Q21070598)Edit

taxon rank (P105): Type taxon (Q16521)Edit

occupation (P106): Conflicts with instance of (P31)Edit

home venue (P115): ContemporaryEdit

located in the administrative territorial entity (P131): Conflicts with instance of (P31)Edit

operator (P137): ContemporaryEdit

IUCN conservation status (P141): Item IUCN taxon ID (P627)Edit

logo image (P154): Commons linkEdit

logo image (P154): FormatEdit

seal image (P158): Commons linkEdit

developer (P178): ContemporaryEdit

doctoral advisor (P184): ContemporaryEdit

doctoral advisor (P184): Value type human (Q5), fictional human (Q15632617)Edit

doctoral student (P185): Value type human (Q5), fictional human (Q15632617)Edit

adjacent station (P197): Item country (P17)Edit

adjacent station (P197): Type entry point (Q228332)Edit

ISNI (P213): FormatEdit

VIAF ID (P214): Allowed qualifiersEdit

VIAF ID (P214): Conflicts with instance of (P31)Edit

ISO 639-1 code (P218): FormatEdit

ISO 639-1 code (P218): Item ISO 639-2 code (P219)Edit

ISO 639-1 code (P218): Item ISO 639-3 code (P220)Edit

ISO 639-2 code (P219): Item IETF language tag (P305)Edit

ISO 639-3 code (P220): Allowed qualifiersEdit

GND ID (P227): FormatEdit

CAS Registry Number (P231): Allowed qualifiersEdit

EC number (P232): Single valueEdit

canonical SMILES (P233): Allowed qualifiersEdit

InChI (P234): Allowed qualifiersEdit

InChIKey (P235): Allowed qualifiersEdit

InChIKey (P235): FormatEdit

ISSN (P236): FormatEdit

FAA airport code (P240): FormatEdit

FAA airport code (P240): Single valueEdit

locator map image (P242): Commons linkEdit

locator map image (P242): FormatEdit

OCLC control number (P243): FormatEdit

Library of Congress authority ID (P244): Conflicts with instance of (P31)Edit

COSPAR ID (P247): FormatEdit

Bibliothèque nationale de France ID (P268): Conflicts with instance of (P31)Edit

CiNii author ID (books) (P271): FormatEdit

GOST 7.75–97 code (P278): FormatEdit

postal code (P281): Conflicts with subclass of (P279)Edit

postal code (P281): Conflicts with instance of (P31)Edit

head coach (P286): ContemporaryEdit

head coach (P286): Value type human (Q5)Edit

vessel class (P289): Type watercraft (Q1229765), vessel (Q16391167), fictional ship (Q16708006), fictional spacecraft (Q14637321)Edit

station code (P296): Conflicts with ESR station code (P2815)Edit

station code (P296): Conflicts with Gares & Connexions ID (P3104)Edit

station code (P296): Conflicts with UK railway station code (P4755)Edit

station code (P296): Conflicts with Amtrak station code (P4803)Edit

station code (P296): FormatEdit

ISO 3166-1 alpha-2 code (P297): FormatEdit

ISO 3166-1 alpha-2 code (P297): Item ISO 3166-1 numeric code (P299)Edit

ISO 3166-1 alpha-2 code (P297): Item top-level Internet domain (P78)Edit

ISO 3166-1 alpha-3 code (P298): Item ISO 3166-1 alpha-2 code (P297)Edit

ISO 3166-1 numeric code (P299): Item ISO 3166-1 alpha-2 code (P297)Edit

ISO 3166-1 numeric code (P299): Single valueEdit

ISO 3166-2 code (P300): FormatEdit

category's main topic (P301): Conflicts with subclass of (P279)Edit

category's main topic (P301): Type Wikimedia category (Q4167836)Edit

IMDb ID (P345): Conflicts with instance of (P31)Edit

Joconde ID (P347): Item collection (P195)Edit

National Diet Library Auth ID (P349): FormatEdit

RKDimages ID (P350): Item collection (P195)Edit

RKDimages ID (P350): Type work of art (Q838948), artwork series (Q15709879), book (Q571)Edit

Entrez Gene ID (P351): Single valueEdit

discography (P358): Unique valueEdit

is a list of (P360): Conflicts with instance of (P31)Edit

part of (P361): Entity typesEdit

Sandbox-String (P370): ScopeEdit

  • Q65499045: Property:P370: ATGCCCGACGCCTCCTCTACCGCGGTGGTAGCCGCCCCTCCTTCCAAAGAGAGGTTGGGTAGCAGCGGAGGCGTGCTGCTACCGCTTGCCGTGGCCGGAGCTGGTCTGCTGTGCCTATGGAAGGCCTTCCAAATTTGCTCCGTTCCCGTTCACCCGCGTTGCGTGACCGTCGTCTACGACACGCGCCGCAAGACGGTCTTGTGCACCTCGGCGGATTGCGAGATGCGCCGGGGCTCACTGCCGCGGGTGTCTCACTTCAACGCGTCACTGTACTTCGGGTCCGCGCTGATGTACTGGAGCCGGACGCGGCTGCTGGTGCCGCCGTCGTCCTTCTTCGGCGTCTTCACGCTTCCGCGCAGCGTCCTCGAGGAGCCGGGCGAGCCCGTGAACTGTGCCGTGGAGGAGGTGGCCGTGCGCGACGGGTCCGTGAACATGATGGTGACTGTCTTCTACACCATCCCCTTCGACCAGGTGGAGCGCTACCTTGCCGCCGTCGGCCCTGAGCCACCGAACGAAGTAATCGGCAAGGCGGTCGCCTACGTTGCACGCGTGCGGTGCGCAGAGCAGTCGGCCGGTATCTTGCTCAGCAAGACCCGCCGCGAAGCGTTCATGGGTCCGTACAAGGACCACCTTACCTCGAAGCTCATGTCGGAGGCGGCGGTGCTGGTGAGGGACGTGGCTGTGGAGAGTGTGGTGCTGCTCGAGGGGGGCTAG
  • Q65500432: Property:P370: ATGGGCAACCAGCTTTTCCTCGTTGCAAATCTGTTAGCCACTGCGCACCGGACTGGCATCCCAGCCTACCTGGAGGCGGCGCCGTTCAGCAGCAGCGCCGAGGGCCCACGTCCCACCTACTGGGACACACTTTTTCGCGACCTCGGTCGTCACGGCGTACAGATGTGTGCGTCCTCGCCGCCGCTGCCTGTCGTGACGGTGCCCGAGACGCGACCCGTGCGGAAGGTGCGACTCGATGCGCAGCGGCCCTGCGCCTTCCACATGATCGGCTTCTTCCAAAGCGATGCCTTCTTCGACGACCACCCGATCATGTCCTCCGTCATCCCGCGGGAGCTGTGGGACTCGGCCCGCGAGCACCTGGCCACCTACTACGGCGGCGGGTCGTGCCACACTGTCGCCCTGCACGTGCGGCGTGGCGACTACACACGTTTTACCGACATCTTCGAGCAGCTCGACGTCGTCGAGTACTACGATGTGGCAGTGCGGCAGCTGCTTGGTGGCCTGCTCTTGCAGCCGCCTTCGCTGCTGCGGCCGCAGCAGTCATCGGTGGACTCGGCCCAAGCGCCGACTGCAGGCACACCGCCGCTGCTGCCGCTTCACTTGCTTGTCTTCTGCGACGAGGAGCGCTTTGGGCGCACCGTTGTGGGGTACTTCCGCACCAAGTACAAGGGTGCCGTGATGGTCAGCCTCGTGTGCGCCGCGACGGAGGCAAGCGCGATATGGGCGAGGCCAACCGCGTCGTCGCCGTCAGTGCCGATAATGCCGCGTGATGTACTGGAGTTGCTGATGATGTCGCAGTGCAACGACGTCGTGATGGCAAACTCGACCTTCTCGTGGTGGGGCGCCTACCTGAACCGCGTCTCACTGCGCCGTGTCATCGCACCGTCCCGGTGGTTCGTGAAGGATCCGTACCCGGCGTCAAATCACCTCTACTGCCCTGGATGGATACTCATCTGA
  • Q65500958: Property:P370: ATGCTGCCGTTTTCTTACCGAGTGCTCATGCGCGGCGTATCGGCGGTGGCCGGTGCGTCGTCCGTGGCTCTGCAGCATCGCGCGCTGGCGGGGACGACGCGCTCGTTCAGCAGCAGCAGCCTGGTGTGGTTGGCGCCAGCCGCGCCGACAACGCAGACGCCGCCGGCGATGGGCGGCGATACGGACGCTGAGGAGACGCACCCTGATTTTCAGCCCCGCATGGTATCCAGCGACCTCGCGCAGGACGAGATCGCCATGATCAAGAAGGATATAGACGACACAATCCGCGATGAGGACATTGTCGTGTTCATCAAGGGCGTTCCGGAGGCGCCAATGTGCGCCTTCTCGAAGCGCATGATTGACGTGATGGAGGCGCTTGGGGTGGAGTACACCTCATTCGACGTGCTCGCTCACCCGGTGGTGCGCAGCTACGTGAAGGAGGTGAGCGAGTGGCCGACGATCCCGCAGTTGTTTGTGAAGGGTGAGTTTGCCGGCGGCGTCGACATCATCCTGAAGATGGCGGAGGGCGGCGACTTGCAGATGCTGCTGGATCAGAAGGGCATCAAGCATCGTGATACCAAACCGTAG
  • Q65516655: Property:P370: ATGGCACTAACGCAGTCTTCTGGTGCGCCGCTGCGCAGTGTGCAAGGCGGCGTAGGAGATGCATCGTACGCGGATGGGGCCGGGCGGGCGCCCGGGCGCGTCAACGGGGCCTCCGCGACACCGCTGCTGACGGAGGAGGCGGTGCAGAGCAGCATTGAGACTTTCGAGGATGCGGCCTGGGTGCGGGAAGAGGCAGTGCGCAGCTACGCAGAGTTCCACAACAACGTCGAGTCGCTGCACGCAACCATGCGCACGCAACTTCGGCCTGTGTGGCGGACAGCGATGCAGCTGCGCCCTGACATCCTCGCGGATGTGCGAGACGAGTGGCGCCTCCGCCGACGTGACAGCATTCCAGACGGCATCCCGATCCCTGCCGCCGCCGCGCAGCACATCGCGCTGCAGGAGACCATACTGAGTGAAGTGGAGGACACGCTGCAGGTGCTGCGCAACACGTCGGTCCGCTTCGCCGCGCATTTCTTGTCGGATGAGGAGAAGATCTCCATGGGCGCAAACCCCGCGTACCTGCGCGCGCCGGACATAGACAAGGAAGTGGTGGTGTCGCGCTCGCAGAGCACTTCCACCTCGCCACAGCGCGCGCTGCCAGCCAGTGTGATGTCAGTTTCCTCGTCTGCAGGAGCTGTGGCGAGTGCCCACATAAAGCCTTCCGCGTCTAGTGCTGCTACTGCTGCCGTCCACACAACACGTGAGGGACACAGTCGTCGCCACCAGGGCAGCCATGCGCAGCACCACCACCACCACAACGACGACGAAGCGGGACTGGTGAGCTCCAGCTCGAACCGGCACGTGCACAGTGGCAAGTCCTCCTGTGCGAGCCGGGGCGCCGGCGACGATCCGCTGTTGGAGGAGTTGCGCAAGCAGTATCAGCTGCGCATTAGGGAACTGAAGGCGCAGTGTGAGGCGGGAGCAAGCCGTCGAAGCGAGCACGGTGCATCGCGATCAGCGGCGGCGACGCCACCGCGGCGCGGTAATCGGGCACGCGTCGCAGCGTCGAGATCATCGTCTCTACCTTCGAGGGCTTCATCGGCGTCTGCGAGTGTATTGACCAGCTCCAGCTCGACAGTGTCGCGTCGCTGA
  • Q65516997: Property:P370: ATGAAGATCACCGTTCACGTGCGAGAGAAGATCATACCGCTGCAGTGCGGCGATGGCACGCAGCAGGTGGTGTGGCTCGGTAACGCAGCCATGATACACTACGACGCTTCCTTTGGCAAGCGCTTCGGCCCGCCGGTGTCGATCCGAAAAGAGGGCGGCGTGCAGTGCGACTTTGAGGCCCGCGTGTGCGACGTGCTGGAGGATGGCCAGCACGTATTTGTGACCCTCGAGAGCGACAGGGGGCAGTAA
  • Q65517494: Property:P370: ATGGCTCTGCCGGGCGTATCACATTATGAGCGCCTGCCCACGCGTACCAAGATTCAGTTCTTCTGGATCTCCATGCTGACGATGGGCTTCGCGTACCAGTTTCTCAAGATGACGGTGCTGCGCGTGCAGCCGAAGCGAGAGGAACAGATGTACATGCACATCCGAAAGGTGTACGGCGACAACATTCCGGAGGAGCTGCTGCAGCGAGCGAAGCGCCAGCGCGAAGCTCAGGATGCGCTGACGCTGACGAACATGCTGCGCACCCCTACACCGGGCCAGACGTCGAACGCGCTGCAGAACGATCTCGACCCTCGAGCCCTCATCAAACTCAAGAGCTGGAACGGGCATTAG
  • Q65517916: Property:P370: ATGTCCGTTGCCTTGGAGTCGCTTCTGCACCGATCCGTGTGCTGCCACCTGGCACACGGTGAGGAGTACCGAGGCCAGCTGGAGGCCCTGGACGGCACCTTCGATGTGGTCCTGTCGCAGTGCACGCGGAGCCGCGCCGCCCCAAGGCAGCCGGCCGAGCCCCTCGTTTTTCTGCGCGGCGAGAACATCATCTACATCGGCTTCGACGAGTCGTCCAGAAGTGAGGACGGGACCACCGCGTGA
  • Q65518515: Property:P370: ATGGGAGGCTGCTGCGGGGTCGCCTCAGAGGCAGGCACGGCCTCGTACAACGACACGGTCTCTTCCACACCATTTCCACCACCGTCACGTCGCGGAAGGTGGCGGGGCTCAACAAGAAGCACCAGCAAGAACGAAAAAGCAGCGCTTAAGAGGAGTGGTAGGCTCGAGTCCGCGCCGTCGTTCCTGGGCAAGATACTACCGCTGAAGGATCGAGGTGACACCGACAGCGCTCCTACCCGCGGCACCGCCGTCGATGCCGTTCCCTCGGCCGCCCCTTTGAAGCTCAGCGATTACGCCACTCTCGCCGCCCCCGAACATGACCAGGACCTGCCTTTCAAAGCCACACCACAGCACGGCGCCAACGGCAGCAGCCCTGACCCGCTCCTGCCTGACCTGTTTTACATCTCCGCTTCCTCGTCCTCATCGCTTCTCGCGAACTGCGACGTGGACGATAGCGCTGAGGACGGCGTTGGCGCCCGTCTTGACGGTGAAGGGCAGAGCTCGCTGGTGGAGGTGAGCCAGCCAACGCAGAGCTTCGCAGGTGATGTGCACACGTACTCGGAGCTGGACTTGACGAGCGAGTGGGAGCCGCCGTCGTTCGATCGCCTTGGCCGGCGGTCGGAGCGTCTGGGCCGCAACGGAACGGACCGCAGCCGACTGCGTCAGCTGATCGTCCGCGAGGCCGAGGTGCGCGCGTCCCTGACGGTCATGTACGTGCATCAGCATCAGCGGTTTTCGCTGAACCTCGCCAAGGAGCACTTCATCGCGGTATACATTAGAATGCGGCAGGAGTACGAGTCGGAGTGGACGGTGCAGTGCATCTGCTGGATCGTTGCGGTAGAGAGTGTCATGCGGGAAGCGCTGGCACGCGAGTGGTGGACGGAGCGAGCCGCTTTAGTGCGCCGAGTCGGGTCTCTCAGGACGCCACCGCCACCACCACTGCGGCCGACGTGCGACGACGCGAGGCTGGGTATCACAGCCATTCACGCACTGAAGCGAGAGGACAGCTTGCCTTACGTATCGAACTTGTACACGGCCGCGGACTTGACCTCCAGCGAGGAGGCAGAGGAGGGCGACCCGCTGAACCTGTGCATCCCGCCCATGCGCGCCTCTTCCTCAATCGCCCTCTTCTCCCCACCGCTGCAGCAGCAGCTCTCGGTGCTTGGCGGATCGCGATCTGCCTCTGCAGGAGTGTCTCGCGGCCTTCGCTCGGCTTCTCGAGTTAGCGCACCACATGCCTCGTCTTTTGTGTCGTCGCCAGCATCGGCCCTTTACTCGCCTGTGCCGACGAAGCGCGTAGCCGCTGCGCAGCAGGCACAGAAGGGCAGGTTCGTGCGGGGGCGGAGCATGGCTGTTACCGAGGCGCTCCTGTGA
  • Q65521701: Property:P370: ATGTACAACGGTGTGGAAGCTGCCGCGGTCAAGGGTACCGGGCTGAGTGGCTATGTTCAGCGCAGCCGCGTGAACGTGTTGGCGACGGGCCGCGTGCCTGCCGAGGAGGGCGCGGCGGCGATGGAGGGCGGGGCGTCCATCAACCCCCTCGAGCAGCGCCGCGCACAGGGCGAGAACCGCGAGATGGCGGCACGGCTTGAGTCTCATCGCGCCTTGCGTGAGGTGCGACTGCGCGTCATGCTCTACCGTGAGGAGCGCGAGGCGGCCGGGGTGGACCCCGTCACAATGGACCGCGAGTGCGGCGAGCTCTACGACTCCTTGCTCGTCGCCGCCAAGCGCCGGCTGAAGGCGCAGCAGAAGACTGAGAACGCCAAGACAGTCGCTAAGTTCGCCGCCGCGTTCGGCGTGAAGGCCACGGCAGCGGTGACCACCTCAGGTGGTGGTGCAGGTAGCGGCAGCGCCTTCGACCGCTCCGTGCAGGAGGTGGAGAAGCACCGCACCGAGGAAGAGCGCCGCCGTCACCAGGAGGCGCAGCTCGTCGAGCACCTGAAGCGTATGCGCCGCGAGGGCAGCGACGCAGTAGAGGGTGCGAACATCTGCGACACAGAGGAGACAGGGATTTAG
  • Q65643840: Property:P370: ATGTACCGCACGGCGCCTCAGATTCTCTTTCAGTTTGTGGGTGGCCTGAGCATCACCCAGTACACCTACCCCATCCTCTACGACGCCTTCACTGGCGAGAAGACCGGTGCCCATGCCGCCACTATCACCACGTCCAGCAGCAGCGGCAGCTTCTCGGGGCTGTGGGGCAGCTTGAAGTGGAGCTTTCAAGCCCCTCCAGTGGATCACACCCTCACAGACGACATCGAGGAACTCCTGCGCACCCACTACTGGCTCGCGTCCGCAGTCCTGTCGCTCACGGTAGTGTCTGGCGGCGCGCCAGCGCTGCTAGGGAGCGGGCTCAGCGTGTACTGCAACGGCGGCCCCGAGGGCAAGGCCCGCTACTCCCTGCTGAAGCAGCGGCTTCGCAACTTCTCCGAGAATGGCAATCACGCATAA
  • Q65645685: Property:P370: ATGCCTCAAAATGCGGCGCAGCTGAACCGGATGCAGATTCGTGAGCAGGAGGCGCTCAACCGGCAGCGCCGCATGCAGGACGACGCGGTGGCACGGCGCGAGGAGGAGGAACTGCGGCGGACAAAGGCCCAATACGACCACGTCAGCTCGCACGGCTACGGACGAGCTGGCAGTGGTGCCGCTGCGCCGAGTGGCAGCCGTGGCGCATCCGACGAGGTGCAGATTCGCGTGTACGTGCGGGAGTGCGACGAGGAGGCGAGCCGGTCCTTCAGCTACCGAGAGGATACCGCTGCTAACTCCACCTCCCACATAGGTCCGCGTTCCGGTGCGTCTGCATCCACGTCGGCCGCTTCGCATGTCGCCAGACGTGGTGTCAACGGCGCGCTGCCACCGATTGGCTCGTCGGGGCGTCTTGGGCCACCGCGCGCGCCAGGGGCCCGTGCGGCGTCCGGCGGTGGTGGCGGCACTTCGGACATCTCAGGTGGTGCGGCATCATGTGGGGTGGTCGCACCGAACCGGGCACGGGTTCCTCGATACCTGCAGCAACGCAAGGCAGAGCTGGCGGCAGAGAAGGAGGCGATCGCCGCAGAGGCGGAGAAGCAGCGGCAACTTTCTCTCATCCCTGCTGGTCAGCGCCGCGTTTCGGAGGAGGAGAAGGCAGACACCCTGCGCCAGCTGGACGAGCGGCAGCAGGAGCTGGAGGGACAGCTGGCCCGCATTCCCATCCGCTTCGACACGCAGTCGATCCAGCAGCGGCGGCGCGCCATCGAGGAGGAACTGCGGCAGATCGAGACGACACGCAACAAGTACAACACCAAAGGGACTCTCTTCATGCCGCTGTGCTAG
  • Q65924744: Property:P370: ATGCGGCGCCTCTTCCTGCTGCTGGCATGGCAGCCATCCTTTGTCAAGCATCTCTCGGAACTGGAGCCGGCGCCGCAGAGAGCGCCCGTAGAGAAGCGACGTAGACAACATATCCCGCTCTCTCTGCAGGCACGCGAGGAGCTGTCCCGCAAGTCGAATGAGCTGCAGTACCATGTCGTCACGCAGGACTGGTTCGGCCAGCGCGTGGATGACTTCGTTATGCAGCACCACCCGGAGTGGGACTACGAGACGGTGAAGCGGCTGGTGCAGCAGGGGCACATCTACCGCTACCGGAAAAACGGAAAGAAGCGATACACGCGGCTGACGGATCGTCTGGAGTTCGATGAGCTTGTCGTCGTGCCGACAGCGAGCTTCTGGGAACGCCAGCTGGCGCCGCCGAGCGGGGTGGAGCTGCAGAGCTCCTCGACGTCGCAGCAGCAGGAGCGGCGGCAGAAGTTTCACCTCTCCGCCAAGACGCGCGAGATGGCGCAGGAGATGGTGCTCTTCAAGAACGAGCACGTCATCGTGATCAACAAGCCGAGCGGCGTGCCGATCATGCCGACGCACGACCCTCTTGCCATGAACATCACAGACCTCCTTCCGGCGTGGCGGTACACTAATACGCAAAAACCGGTCATATGCCACAACCTTGACACCGAGACGAGCGGGTGCGTGGTGCTGGCGCGCAGTGCGAACGCGCACCGCATGCTGGGCCGCATGTTTGTGAAGCGTGTAGTGCCGAACAGCGTGTACTGGGGTTTCGCGGTAGGGAAGCCGCCAGTGAATTTCGGCCGCATTCGCATGCACTTCGAGATTCAGAAGGGGCAGGGCGGCGATGTCATTGTTGCTCGCCCCACCCCCACCGCAGACTCCAAGGTAGGCATCGCCGAGTTCGTTGTGAATGCCTCCGCGCTGGAGTTCGGCAGCTTCATCTCCTTTTACCCACTGACGACGCGGCGGCATCAGGAGCGCATTATGGCCGCCCACGCGCTGCGAGCCCCGCTCCTTGGCGACGCGAAGTATGGTGGCGAGAGCGCCTTCCCGCACTCCCTGTCGCTCTTCTGGGACCCCGCCCGCAAAGACGTCCCACTGCACCTCCATCACCGCAAGATTCAGCTCCCCTACAAGAACGGCGCCGGTGAGTTTGTGTGCGTCACGGCGCCGCTGCCGCCGCACATGGAGAAGACGTTCAAGCGGTTGGGGTGGCCAGTCGACGCTGATGACCCACTTATCCCTGGTTGA
  • Q65924753: Property:P370: ATGTCCACATACGACAAATCAGATCAGATCGGCTATGATGAGACGGATAATACGTTGAATGCCGAGCTGGAAGAAATGATGGCGCGCACCCCACCGGAGGTGCAGCGCCACCTGCAGCACCGCATTCATGATGGCATCCTGCAGCGCATGAAAGAGGAGACGACACGCAAGTGCATTACGTTCATCCAAAAGTATGAGCAGTGTGTGAACAGCCAAAAGCCGTACAACATGAAGCTATGCTATCCCCACCGGGATGCTATGAATGGGTGCGCGCAGGAGGTTAACCGGGAGGAAAACTACCAACGTTACCGCATCATGTACCTCCGTGGCGAGCTGCTTAGGTACCATGAGAAACGTATTGCCGGCAAGATGGAGGCATTCAAGGTGAAGGCTCCCGACGCGATCCGTGGGTGGAAGCACGACTACGCACCCAAGTATATGCACATGATGGAGGATTTGGGGGCGGCGCCTCTCGGCAATGCCGTGGGGACGGCGGAGGAAACCACAAACTCGAAGTAG
  • Q65924767: Property:P370: ATGGCCCGTGGCAACCAGCGTGATCTCGCGCGGGAGAAGAACATGAAGAAGCAGCAGCAGAAGAACAAAGGTCACCGCGAGGACGGTCTTTCCCACGCTGCGCGCAGAGAGGCGGATGCCGAGGCGATGCGTCTGAAGCAGGCCGCTGCTGCGGAGCGGAAGGCTGCCGGAGGCTCGTGA

INSEE municipality code (P374): Item located in the administrative territorial entity (P131)Edit

space launch vehicle (P375): Single valueEdit

located on astronomical location (P376): Value type substellar object (Q3132741), fictional astronomical object (Q15831598)Edit

Mérimée ID (P380): Item located in the administrative territorial entity (P131)Edit

Mérimée ID (P380): Item country (P17) = France (Q142)Edit

PCP reference number (P381): Item heritage designation (P1435) one of class A Swiss cultural property of national significance (Q8274529), class B Swiss cultural property of regional significance (Q12126757)Edit

CBS municipality code (P382): FormatEdit

CBS municipality code (P382): Item located in the administrative territorial entity (P131)Edit

CBS municipality code (P382): Item country (P17) one of Netherlands (Q55), Kingdom of the Netherlands (Q29999)Edit

CBS municipality code (P382): Item coordinate location (P625)Edit

CBS municipality code (P382): Unique valueEdit

SBN author ID (P396): FormatEdit

taxon author (P405): ScopeEdit

soundtrack release (P406): Type work (Q386724), group of works (Q17489659)Edit

Libraries Australia ID (P409): FormatEdit

Libraries Australia ID (P409): Unique valueEdit

military rank (P410): ContemporaryEdit

voice type (P412): Type human (Q5), fictional character (Q95074), role (Q1707847)Edit

position played on team / speciality (P413): Type human (Q5), fictional human (Q15632617)Edit

field of this occupation (P425): Conflicts with field of work (P101)Edit

field of this occupation (P425): Conflicts with industry (P452)Edit

taxonomic type (P427): Value type taxon (Q16521), type (Q3707858)Edit

dantai code (P429): Item located in the administrative territorial entity (P131)Edit

dantai code (P429): Single valueEdit

MusicBrainz artist ID (P434): FormatEdit

MusicBrainz release group ID (P436): FormatEdit

German municipality key (P439): FormatEdit

German municipality key (P439): Type municipality of Germany (Q262166), unincorporated area in Germany (Q15974311)Edit

German district key (P440): Item country (P17) = Germany (Q183)Edit

German district key (P440): Item coordinate location (P625)Edit

German district key (P440): Unique valueEdit

China administrative division code (P442): FormatEdit

review score (P444): FormatEdit

review score (P444): Mandatory QualifiersEdit

astronaut mission (P450): InverseEdit

astronaut mission (P450): Value type manned spacecraft (Q7217761), spaceflight (Q5916), fictional spacecraft (Q14637321)Edit

partner (P451): ContemporaryEdit

partner (P451): Item sex or gender (P21)Edit

partner (P451): Type human (Q5), fictional character (Q95074), legendary figure (Q13002315), mythical character (Q4271324), deity (Q178885), mythical creature (Q2239243), doll (Q168658), animal (Q729)Edit

partner (P451): Value type human (Q5), fictional character (Q95074), legendary figure (Q13002315), mythical character (Q4271324), animal (Q729), deity (Q178885), mythical creature (Q2239243)Edit

Emporis building ID (P455): FormatEdit

Emporis building ID (P455): Type architectural structure (Q811979), statue (Q179700)Edit

IMO ship number (P458): FormatEdit

sRGB color hex triplet (P465): FormatEdit

Eight Banner register (P470): Single valueEdit

country calling code (P474): FormatEdit

Canadian Register of Historic Places ID (P477): Type geographical object (Q618123), artificial physical object (Q8205328), group of physical objects (Q61961344)Edit

FilmAffinity ID (P480): FormatEdit

FilmAffinity ID (P480): Single valueEdit

FilmAffinity ID (P480): Unique valueEdit

Palissy ID (P481): FormatEdit

Palissy ID (P481): Item country (P17) = France (Q142)Edit

OMIM ID (P492): FormatEdit

CBDB ID (P497): Item instance of (P31) one of human (Q5), human who may be fictional (Q21070568)Edit

HURDAT identifier (P502): FormatEdit

HURDAT identifier (P502): Unique valueEdit

ISO 15924 alpha-4 code (P506): FormatEdit

BNCF Thesaurus ID (P508): FormatEdit

BNCF Thesaurus ID (P508): Unique valueEdit

academic degree (P512): Type human (Q5), fictional character (Q95074), person (Q215627)Edit

runway (P529): Allowed qualifiersEdit

Find A Grave memorial ID (P535): FormatEdit

Find A Grave memorial ID (P535): Type person (Q215627), conjoined twins (Q216866), horse (Q726), animal (Q729), pig (Q787), orca (Q26843), Gorilla (Q36611), horned lizard (Q288720), Pan troglodytes (Q4126704), group of humans (Q16334295), cenotaph (Q321053), fictional human (Q15632617), memorial (Q5003624)Edit

Find A Grave memorial ID (P535): Unique valueEdit

office contested (P541): ContemporaryEdit

officially opened by (P542): Target required claim sex or gender (P21)Edit

officially opened by (P542): Value type human (Q5)Edit

Mathematics Genealogy Project ID (P549): FormatEdit

Mathematics Genealogy Project ID (P549): Single valueEdit

website account on (P553): None ofEdit

website account on (P553): Value type communication medium (Q340169), repository (Q3133368), online chat (Q287198), distributed social network (Q5283178)Edit

website username (P554): ScopeEdit

doubles record (P555): Single valueEdit

crystal system (P556): One ofEdit

crystal system (P556): Value type crystal system (Q898786)Edit

singles record (P564): FormatEdit

singles record (P564): Single valueEdit

basionym (P566): Single valueEdit

IPNI author ID (P586): Type human (Q5)Edit

MMSI (P587): Single valueEdit

MMSI (P587): Type watercraft (Q1229765), radio station (Q1474493), sea mark (Q7321258), Maritime Rescue Coordination Centre (Q56885501)Edit

point group (P589): One ofEdit

GNIS ID (P590): FormatEdit

ChEMBL ID (P592): Single valueEdit

WTA player ID (P597): Conflicts with instance of (P31)Edit

WTA player ID (P597): Item occupation (P106) one of tennis player (Q10833314), wheelchair tennis player (Q18814798)Edit

WTA player ID (P597): Item sex or gender (P21) one of transgender female (Q1052281), female (Q6581072)Edit

WTA player ID (P597): Item instance of (P31) = human (Q5)Edit

WTA player ID (P597): Unique valueEdit

ITF player ID (P599): Item occupation (P106) one of tennis player (Q10833314), wheelchair tennis player (Q18814798), professional tennis player (Q48673045)Edit

MedlinePlus ID (P604): FormatEdit

conflict (P607): Conflicts with instance of (P31)Edit

mother house (P612): Type monastery (Q44613)Edit

OS grid reference (P613): Item country (P17) one of United Kingdom (Q145), Isle of Man (Q9676), Kingdom of England (Q179876)Edit

time of spacecraft launch (P619): Single valueEdit

time of spacecraft orbit decay (P621): Type spacecraft (Q40218)Edit

IUCN taxon ID (P627): Unique valueEdit

cultural properties of Belarus reference number (P632): FormatEdit

cultural properties of Belarus reference number (P632): Single valueEdit

Quebec cultural heritage directory ID (P633): Allowed qualifiersEdit

Quebec cultural heritage directory ID (P633): Single valueEdit

ISTAT ID (P635): FormatEdit

ISTAT ID (P635): Single valueEdit

Léonore ID (P640): FormatEdit

Léonore ID (P640): Item sex or gender (P21)Edit

Léonore ID (P640): Item date of birth (P569)Edit

Léonore ID (P640): Unique valueEdit

Freebase ID (P646): Conflicts with instance of (P31)Edit

Freebase ID (P646): FormatEdit

drafted by (P647): Value type sports organization (Q4438121)Edit

NRHP reference number (P649): FormatEdit

Biografisch Portaal number (P651): FormatEdit

Biografisch Portaal number (P651): Type human (Q5), group of humans (Q16334295), fictional human (Q15632617)Edit

Biografisch Portaal number (P651): Unique valueEdit

UNII (P652): FormatEdit

PubMed Health (P653): Type physiological condition (Q7189713)Edit

RTECS number (P657): FormatEdit

eMedicine (P673): FormatEdit

ÚSOP code (P677): Type natural monument (Q23790), protected area (Q473972), remarkable tree (Q811534)Edit

ZVG number (P679): Unique valueEdit

NCBI Taxonomy ID (P685): FormatEdit

NCBI Taxonomy ID (P685): Single valueEdit

Gene Ontology ID (P686): Single valueEdit

BHL Page ID (P687): FormatEdit

space group (P690): Value type space group (Q899033)Edit

NKCR AUT ID (P691): Conflicts with instance of (P31)Edit

NKCR AUT ID (P691): FormatEdit

replaced synonym (for nom. nov.) (P694): Type taxon (Q16521), scientific name, published under a Code of nomenclature (Q23729754)Edit

replaced synonym (for nom. nov.) (P694): Value type taxon (Q16521), scientific name, published under a Code of nomenclature (Q23729754), scientific name (Q10753560)Edit

PubMed ID (P698): Allowed qualifiersEdit

PubMed ID (P698): Conflicts with instance of (P31)Edit

PubMed ID (P698): Conflicts with found in taxon (P703)Edit

PubMed ID (P698): FormatEdit

diocese (P708): Allowed qualifiersEdit

Strunz 8th edition (series ID, updated) (P711): FormatEdit

Strunz 8th edition (series ID, updated) (P711): Single valueEdit

Nickel-Strunz '10th ed', review of (9th ed/ 2009 update) (P713): Item IMA status and/or rank (P579)Edit

JPL Small-Body Database ID (P716): Single valueEdit

Canmore ID (P718): Unique valueEdit

asteroid spectral type (P720): Item minor planet group (P196)Edit

asteroid spectral type (P720): Type asteroid (Q3863)Edit

asteroid spectral type (P720): Value type asteroid spectral type (Q1750705)Edit

OKATO ID (P721): Allowed qualifiersEdit

OKATO ID (P721): Conflicts with instance of (P31)Edit

OKATO ID (P721): Conflicts with is a list of (P360)Edit

OKATO ID (P721): FormatEdit

OKATO ID (P721): Item country (P17) = Russia (Q159)Edit

DBNL author ID (P723): FormatEdit

DBNL author ID (P723): Unique valueEdit

Internet Archive ID (P724): FormatEdit

Europeana ID (P727): FormatEdit

Europeana ID (P727): Unique valueEdit

service retirement (P730): Conflicts with instance of (P31)Edit

family name (P734): Conflicts with family name identical to this given name (P1533)Edit

family name (P734): Conflicts with instance of (P31)Edit

given name (P735): Conflicts with family name identical to this given name (P1533)Edit

given name (P735): Conflicts with instance of (P31)Edit

given name (P735): Conflicts with main subject (P921)